86
|
American Radiolabeled Chemicals Inc
udp Udp, supplied by American Radiolabeled Chemicals Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/14c+glcnac+udp/pm40942141-190-4-8 Average 86 stars, based on 1 article reviews
udp - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
American Radiolabeled Chemicals Inc
ci mmol Ci Mmol, supplied by American Radiolabeled Chemicals Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/ci+mmol/pm41372689-33-16-34 Average 86 stars, based on 1 article reviews
ci mmol - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
American Radiolabeled Chemicals Inc
studywere Studywere, supplied by American Radiolabeled Chemicals Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/studywere/pm41807381-324-12-18 Average 86 stars, based on 1 article reviews
studywere - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
90
|
American Radiolabeled Chemicals Inc
14c]oleoyl-coa 14c]Oleoyl Coa, supplied by American Radiolabeled Chemicals Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/14c+coa+oleoyl/pmc01550299-115-26-29 Average 90 stars, based on 1 article reviews
14c]oleoyl-coa - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Promega
radiolabeled rps25 probe Radiolabeled Rps25 Probe, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/radiolabeled+rps25+probe/pmc02788332-435-2-10 Average 90 stars, based on 1 article reviews
radiolabeled rps25 probe - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
NEN Life Science
radiolabelled estradiol ([2,4,6,7- 3 h]-estradiol (90 ci/mmol) Radiolabelled Estradiol ([2,4,6,7 3 H] Estradiol (90 Ci/Mmol), supplied by NEN Life Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/radiolabelled+estradiol+++2+4+6+7++3+h++estradiol++90+ci+mmol+/pmc02913251-40-25-35 Average 90 stars, based on 1 article reviews
radiolabelled estradiol ([2,4,6,7- 3 h]-estradiol (90 ci/mmol) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Promega
32 p-radiolabeled consensus oligonucleotides 5'agttgaggggactttcccaggc-3 32 P Radiolabeled Consensus Oligonucleotides 5'agttgaggggactttcccaggc 3, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/32+p+radiolabeled+consensus+oligonucleotides+5+agttgaggggactttcccaggc+3/pmc03226551-74-55-64 Average 90 stars, based on 1 article reviews
32 p-radiolabeled consensus oligonucleotides 5'agttgaggggactttcccaggc-3 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Promega
35 s-radiolabelled proteins 35 S Radiolabelled Proteins, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/35+s+radiolabelled+proteins/pmc03017119-270-21-26 Average 90 stars, based on 1 article reviews
35 s-radiolabelled proteins - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Promega
radiolabelled markers Radiolabelled Markers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/radiolabelled+markers/10__1042_slash_bj3480675-76-17-30 Average 90 stars, based on 1 article reviews
radiolabelled markers - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
DuPont de Nemours
radiolabelled 1-14c-butyrate Radiolabelled 1 14c Butyrate, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/radiolabelled+1+14c+butyrate/pm11860416-38-0-11 Average 90 stars, based on 1 article reviews
radiolabelled 1-14c-butyrate - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Promega
gfp cdna radiolabeling kit Gfp Cdna Radiolabeling Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/gfp+cdna+radiolabeling+kit/pm16730344-63-5-7 Average 90 stars, based on 1 article reviews
gfp cdna radiolabeling kit - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
DuPont de Nemours
radiolabeled microspheres Radiolabeled Microspheres, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/radiolabelling+system/radiolabeled+microspheres/pmc03867789-95-39-9 Average 90 stars, based on 1 article reviews
radiolabeled microspheres - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |